Skip to content

Le gène du géocaching/The geocaching gene Mystery Cache

Hidden : 04/03/2006
Difficulty:
4 out of 5
Terrain:
3 out of 5

Size: Size:   small (small)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:


Les coordonnées ci-haut sont celles de la faculté de médecine de l’Université McGill. Ne vous y rendez pas!

Comme tous les géocacheurs le savent, cette activité présente un très haut potentiel d’accoutumance, avec toutes les conséquences néfastes qui en découlent.

Les scientifiques étudiant cette question ont longtemps cru qu’il s’agissait d’un simple trouble du comportement, acquis à l’usage. Cependant des recherches récentes menées par l’équipe du centre de génomique de l’Université McGill, à Montréal, semblent supporter une autre hypothèse.

En étudiant les chromosomes de 52 géocacheurs à un stade pathologique avancé (3000 caches et plus) ces chercheurs ont mis en évidence, sur le chromosome 17, une suite de nucléotides qui se retrouvaient de façon reproductible chez les géocacheurs, mais pas dans une population saine. Ils ont alors émis l’hypothèse que cette séquence pourrait coder une protéine anormale, qui restait à identifier.

Finalement c’est suite à l’autopsie d’un géocacheur décédé d’une chute accidentelle en tentant de faire la cache Hellmouth sur le Mont-Royal que les scientifiques ont effectivement détecté la présence d’une protéine, la géocachine, infiltrant les neurones du système nerveux central. Il semble donc maintenant clairement établi que le géocaching est dû à un défaut génétique bien identifié.

Vous trouverez ci-dessous la séquence de nucléotides codant cette protéine. Il est fort probable que la synthèse en laboratoire de la protéine en question permettra de faire avancer les recherches dans le domaine.

La cache se trouve à N 45° 30 de latitude et W 073° 34 de longitude. La résolution de l’énigme (en remplaçant, dans votre réponse, la lettre Q par la lettre X) vous permettra de trouver les décimales du site. La solution est évidemment en anglais, car on est à McGill!

The above coordinates are those of the McGill university school of medicine. Do not go there!

It is widely known among geocachers that this activity presents a very high potential of addiction, with all the untoward consequences.

Scientists who have studied this problem have long thought that it was caused by a simple behavioural trouble, acquired by use. However, recent research performed by the team of the Center of genomic of the McGill university in Montreal seems to support another hypothesis.

By studying the chromosomes of geocachers at and advanced pathologic state (3000 founds and more) those researchers have found, on chromosome 17, a string of nucleotides that where repeatedly present among geocachers but not in normal controls. The hypothesis was then made that this string could code an abnormal protein, yet to be identified.

Finally, the accidental death of a geocacher from a fall during an attempt to get the Hellmouth cache on Mont-Royal gave the answer to the puzzle. The scientists found an abnormal protein, called “geocachin”, infiltrating the central nervous system neurones. It is now clearly established that the geocaching disease is caused by a specific genetic defect.

You will find underneath the nucleotide sequence encoding this protein. The synthesis in laboratory of this protein will help move forward the research.

The latitude of the cache is N 45° 30, and the longitude is W 073° 34. The resolution of the puzzle (replacing, in your answer, the letter Q by the letter X) will enable you to find the decimals of the coordinates. The answer is in English, of course, since we are at McGill!

AAUUAAACUCAUAGAGAAGAGUAAUCUAUUCAAUAGUCCGAAGUAGAGAAU
UGGUGAGAAAUUGGACACACAUGAUCAAUACAGUAGGAGAUAGGGCAUACG

Additional Hints (Decrypt)

Yr pbqr qr yn ivr/Gur pbqr bs yvsr

Decryption Key

A|B|C|D|E|F|G|H|I|J|K|L|M
-------------------------
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

(letter above equals below, and vice versa)