You (probably 
) have 46 chromosomes in each of
your somatic cells. Each cell has essentially the same set of
chromosomes, which are composed of DNA - the recipe for all of
the structural and functional proteins in your body. DNA is
made up of 4 types of nucleotides. These are called Adenine
(A), Cytosine (C), Guanine (G), and Thymine (T). These
nucleotides combine in groups of 3 to code for an amino acid.
By combining in any fashion possible, these 4 nucleotides can
produce 64 unique codes. With only 20 types of amino acids
available for protein formation, many of these codes double up and
are used for the same amino acid. Eg: The first codon and the
second codon both code for the amino acid "Phenylalanine", whilst
the sixty-first, sixty-second, sixty-third and sixty-fourth all
code for "Glycine". A couple of the codes are “stop” codons – these
do not code for any amino acid and instead result in a break of the
chain.
The DNA is copied, in a process known as transcription, to
produce messenger RNA (mRNA) which then instructs special
organelles called ribosomes on how to form the correct amino acid
sequence. The resultant chain of amino acids linked together by
peptide bonds is called a protein. Your task is to decode the DNA
strand in order to find the cache. If you come across a "stop"
codon, then disregard its codon number and use it as a break in the
chain.
DNA sequence of this Protein Fore!mation:
AATGAAATTCATACTCCTAATATCCAGTAAATCAAGATTGAGGCAATC
Table of codons:
FTF: Eynowd