Skip to content

<

TATAAA

A cache by Sól & Rahl Send Message to Owner Message this owner
Hidden : 08/06/2008
Difficulty:
4.5 out of 5
Terrain:
2.5 out of 5

Size: Size:   small (small)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:



AACCCATTCAGCTCAGGTATCACTCACATACGCTATTGTGTACTATATCCAAGCTACGTGTGTGCCAGCGGCACCGGGATTACATTGGCGACTTCTTTCAGCTGTGGCTCAGTCAGATTACTACGTTTTCACTTACTGGTTATCACCCCCAAAAACGCACTTAGCGACCGCGCGATTGGTTGCTCTATATCTGCTATCCCGTCGGTGTGCCCTCAGACGACCCCAAGCACTATATTCCTATCCAAGTGCACCAATATTTATCGAACGTCCTACGGTCGACTATCAGTCGTCAGTTGTTTCTCATGGACGAGCGCTGTGCTTGTCACGAACTCATCGAGGGTACCCATTTACAGACAACTGGAAACAAAGCGGCAGTCATCGAAACCTGGCTGTCGACACGACTTTTGGCACAGTATCGCAACTCCATATCGAGCGTTGGGAGATCACCGAGAGGGTCATCGAGCGGAACGAGGTCAACGACAGAGAGATCTGTTGGGAGATCTGCTGGGAGATCGACAGGGAAATCAACGAGGTCAACGAAATCAATTCGAACGTCCTTTTGTTTGTGGAAAACTTCAACGAGGTCAACTGCTGGGAAATCGAAATCAACTCGAACGTTTTACTTTAACGGCACAGTATCGCAACCG
TTGGGTAAGTCGAGTCCATAGTGAGTGTATGCGATAACACATGATATAGGTTCGATGCACACACGGTCGCCGTGGCCCTAATGTAACCGCTGAAGAAAGTCGACACCGAGTCAGTCTAATGATGCAAAAGTGAATGACCAATAGTGGGGGTTTTTGCGTGATCGCTGGCGCGCTAACCAACGAGATATAGACGATAGGGCAGCCACACGGGAGTCTGCTGGGGTTCGTGATATAAGGATAGGTTCACGTGGTTATAAATAGCTTGCAGGATGCCAGCTGATAGTCAGCAGTCAACAAAGAGTACCTGCTCGCGACACGAACAGTGCTTGAGTAGCTCCCATGGGTAAATGTCTGTTGACCTTTGTTTCGCCGTCAGTAGCTTTGGACCGACAGCTGTGCTGAAAACCGTGTCATAGCGTTGGGTATAGCTCGCAACCCTCTAGTGGCTCTCCCAGTAGCTCGCCTTGCTCCAGTTGCTGTCTCTCTAGACAACCCTCTAGACGACCCTCTAGCTGTCCCTTTAGTTGCTCCAGTTGCTTTAGTTAAGCTTGCAGGAAAACAAACACCTTTTGAAGTTGCTCCAGTTGACGACCCTTTAGCTTTAGTTGAGCTTGCAAAATGAAATTGCCGTGTCATAGCGTTGGC


10/2010 auf final geschrumpft, 03/2011 Frameshifts entfernt, 6/2011 Mutation beim entfernen des Frameshifts rauskloniert, 03/2012 jetzt wieder mit Stage1 & Final, 03/2012 die unvermeidliche Mutation korrigiert, danke an Seve.

Additional Hints (No hints available.)