Skip to content

Untraceable DNA Mystery Cache

This cache has been archived.

*gln: [b][green] ARCHIVING Disabled cache. [/b][/green]

[B][Green] NOTE: do not select reply in your e-mail program if you wish to respond to this message from the geocaching.com mail bot. Go to your cache page and e-mail *gln from the log there OR email us at Glenn.GeocachingAdmin@gmail.com OR Mongo@geocachingadmin.com , referencing the cache URL's, or GCxxxx waypoint numbers. [/green][/b]

Greetings,

It has been a while since I first looked at this cache. I can't find any recent responses about maintaining this cache so for the time being it will be archived and removed from the active cache listings. We are no longer leaving caches stay disabled for extended periods of time.

Groundspeak and the geocaching community appreciate your contributions to geocaching and I hope to see this cache back in operation soon.

If you can get it back up and running in the next week or so contact me to get it re-listed. Otherwise plan to move it slightly and set up a new cache page.

[B][Green]Most problems can be solved with good communication so reply back to the reviewer and we will do everything possible within the guidelines to get your cache published. It is best to give me as much information as possible instead of saying nothing at all. This will speed up the process and we can get your cache published. [/green][/b]

Glenn

"Seek quality, not quantity".

Your friendly Missouri Geocache Review team is
Glenn (*gln), & Mongo

How to get your cache published quickly: http://tinyurl.com/yhnva3g

Areas needing permission in Mo. http://tinyurl.com/lgyy84
Geocaching Knowledge Books http://tinyurl.com/yd459kh
Frequently Asked Questions http://tinyurl.com/2re5k6
The Guidelines http://tinyurl.com/bdf5m
Missouri Geocaches to be Archived http://tinyurl.com/87cqw

NEW MoGeo Calendar of Events http://mogeo.ipbhost.com/index.php?app=calendar
Dave's Handy Hiding Hints http://www.ratisher.com/geocache_hiding.htm

August 12, 2010 11:20 AM by *gln

More
Hidden : 7/29/2009
Difficulty:
3 out of 5
Terrain:
1.5 out of 5

Size: Size:   small (small)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:


ATTENTION!!! There is no cache at the listed coords. Following the steps below WILL lead you to the CORRECT coords

As a world renowned genetic scientist I have spent years looking at the human DNA code to figure out what separates the average cacher from the experts. I have found the secret hidden in the chain as a result of my hard work and studies. I am set to give a lecture on this subject in a few days so I must go and finish up on my speech. Stay in the loop and you might find the secret to the power of the cacher.

Where is it?!?!? I had the item in my briefcase this morning on my way to work and it must of fallen out the window on the way. I guess this would be a perfect time to put my research to work.. Calling all cachers!! I need your help. Below it the chain of DNA that led me to the location of the secret item of great power in the first place. It should be a prime location to start looking.

Don’t think you can run out the door when I release my work, since it took me years to find this in the first place. Time is slipping away and I need this item FOUND for my speech.

When and if you can understand my work, you will arrive on location to look for a lockbox containing the item and a slip of paper. Please do not try to attempt to return this to me, as I only need to know it has been found. Better hurry. Its still not rocket science but its a specialty that takes time to understand.. good luck and remember persistence pays off!!!

AND AS ALWAYS PLEASE DO NOT GIVE AWAY ANY CLUES IN YOUR LOGS :)

Dont forget your pen!!

Atcgcc. Agca. Atgctagcatgccgatatgctagcatgcc Gatatgctagcatgccgatatgctagcatgccgatatgctag

catgccgt atgctagcatgccgtatgctagcatgccgt

taatcggctagc. Acggcaa. Atcggcattagcatcggcattagcatcg gcattagcatcggcattagcatcggcatt

agcatcggcattagc atcggcattagcatcggcattagcatcggcattagc

Additional Hints (Decrypt)

Unir na ncc fgber? Trbpnpuvat gbbyxvg vtpg pna or lbhe sevraq.. Ng tm or farnxl naq fgnl ybj..

Decryption Key

A|B|C|D|E|F|G|H|I|J|K|L|M
-------------------------
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

(letter above equals below, and vice versa)