Cache Coordinates = GGGGCCAATTGCTAACCCAGAAAGTACCGAAAACAGCTTGTGTTT
Your task is to transcribe the above sequence of DNA triplets
into mRNA codons and then use The Genetic Code wheel to determine
which amino acid is coded for by that particular codon.
>
I have included a very brief description of a very complex and
wonderful process. I hope it helps.
Our cells create large biological molecules known as proteins.
The basic sub-unit of proteins are amino acids and they come in 20
different types. The exact sequence of amino acids in a protein
chain determines how that chain will fold into its
three-dimensional structure. The precise three-dimensional
structure of a protein will determine its function.
DNA is considered the blueprint of life. It contains the
molecular instructions on how to make the cells of every living
organism on Earth. More precisely, it contains the instructions on
how to make proteins. To get the protein building instructions from
DNA (in the nucleus) to where the proteins are built (ribosomes in
the cytoplasm), the DNA will need to be transcribed into messenger
RNA (mRNA). This is done by matching base pairs of DNA with the
complimentary mRNA base pairs. For the process of transcription to
occur, the following rules must be followed:
The four base pairs of DNA are A, T, C, and G
The four base pairs of mRNA are A, U, C, and G
Adenine pairs with Uracil and Thymine
Guanine pairs with Cytosine
The DNA is “read” in groups of 3 bases in a row
known as triplets. For example, TTC is a DNA triplet.
mRNA is transcribed from DNA into 3 base units known as codons. For
example, UUU is a codon.
After the DNA is transcribed into mRNA, the appropriate amino acid
sequence can be put together to create a protein.
You can check your answers for this puzzle on
Geochecker.com.