Skip to content

Blueprint of Life Mystery Cache

This cache has been archived.

Wis Kid: As there has been no owner action in the last 30 days, I am regrettably forced to archive this listing.

More
Hidden : 1/31/2010
Difficulty:
3 out of 5
Terrain:
1.5 out of 5

Size: Size:   micro (micro)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:

Many puzzle caches involve the use of intricate codes that need to be “cracked” in order to determine the coordinates.
I thought this puzzle would be a way to incorporate the ultimate code into geocaching: The Code of Life.


Cache Coordinates = GGGGCCAATTGCTAACCCAGAAAGTACCGAAAACAGCTTGTGTTT

Your task is to transcribe the above sequence of DNA triplets
into mRNA codons and then use The Genetic Code wheel to determine which amino acid is coded for by that particular codon.

The Genetic Code>

I have included a very brief description of a very complex and wonderful process. I hope it helps.


Our cells create large biological molecules known as proteins. The basic sub-unit of proteins are amino acids and they come in 20 different types. The exact sequence of amino acids in a protein chain determines how that chain will fold into its three-dimensional structure. The precise three-dimensional structure of a protein will determine its function.


DNA is considered the blueprint of life. It contains the molecular instructions on how to make the cells of every living organism on Earth. More precisely, it contains the instructions on how to make proteins. To get the protein building instructions from DNA (in the nucleus) to where the proteins are built (ribosomes in the cytoplasm), the DNA will need to be transcribed into messenger RNA (mRNA). This is done by matching base pairs of DNA with the complimentary mRNA base pairs. For the process of transcription to occur, the following rules must be followed:


The four base pairs of DNA are A, T, C, and G


The four base pairs of mRNA are A, U, C, and G


Adenine pairs with Uracil and Thymine


Guanine pairs with Cytosine


The DNA is “read” in groups of 3 bases in a row known as triplets. For example, TTC is a DNA triplet.
mRNA is transcribed from DNA into 3 base units known as codons. For example, UUU is a codon.

After the DNA is transcribed into mRNA, the appropriate amino acid sequence can be put together to create a protein.

You can check your answers for this puzzle on Geochecker.com.

Additional Hints (No hints available.)