The cache is not at the posted coordinates!
The FTF prize, however, was purchased there.
Last night I had the most vivid dream. I was climbing a spiral staircase, which wound above me until it disappeared into a glow of brilliant light. The treads were narrow and the climb was steep. I looked down lest I misstep and fall, and noticed that each stair step had a bold capital letter written on it. I took pains to memorize these letters as I climbed, reciting them in my head, wondering what they could mean. I was certain that if I could only understand them, they would reveal a great mystery. Suddenly, the stair was shaken as if by a massive earthquake, and began to split in two, right down the middle, coming apart like a zipper. I lunged for the handrail, missed, and plunged headfirst into the murky depths below. I seemed to fall endlessly, and as I fell, I was still reciting the letters, audibly now, shouting them into the darkness. I woke with a jolt. Amazed that I could still remember the sequence of letters, I immediately grabbed a pencil and committed the message to paper. Here is what I wrote:
GCTATGATGCAATGTGCCAATTAAAACCAGCGTACTCATTTTCAACGCACCTATTTCATTGTTGAAGATGAG GGTCGTGAAGAGTCTACATGGGAAAATACGTATTTTCAAGTACGCCCTCAGATCAACACTGAGATTGGTCAT ACCCAGAATGAAACATGGCAAATGATTAATGTTACAGAGTCTTAGTGGGAATCCACCCAAAATGAACATGTG AACGACCGCGAGGATACATGGGAAAATACGTATACCTGGCAAGATGAGGGTCGTGAAGAGTCTTTTCAACGC ACCTATACACACAGAGAAGAGCCTCAGATCAACACTTTTCAAGTACGCTTTCAAGTACGCGAAATCGGGCAT ACAATGATTAATGTTACAGAGTCTTGA
NOTE: The cache is only a few steps from a small side trail. If it looks like you need to go bushwhacking, look for another way. BEWARE of poison oak in the area. It was not there when we placed the cache, but the area is not maintained and quite a bit has grown since.
*** Congratulations to FTF JAShaws ***