Skip to content

Twisted Language Mystery Cache

This cache has been archived.

F Troopers: Delayed archiving this due to an out of state trip followed by requests to keep it going for a few more finders. However, the time has come. Made the trek and removed the container this morning. The poison oak is sprouting and leafing out nicely, and has spread even further down the hill than last year. Too bad; GZ is still a very cool, lesser known corner of a very popular park. A big thank you to Mariner Mike for placing the previous cache that led us to discover this area in the first place. It was a good run, and all those who solved this and made the find have our deepest gratitude. Happy caching!

More
Difficulty:
4.5 out of 5
Terrain:
3.5 out of 5

Size: Size:   regular (regular)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:

PLEASE NOTE: Due to the huge amount of poison oak that has grown up all over the area, I am planning to archive this cache soon. Projected removal date is on or about 7/30/2013. If you have solved the puzzle and want to claim a find without risking the virtually certain contact with poison oak, email me and we'll work something out. Or if you are immune and willing to brave the noxious plants, do it soon.


The cache is not at the posted coordinates!


The FTF prize, however, was purchased there.

Last night I had the most vivid dream. I was climbing a spiral staircase, which wound above me until it disappeared into a glow of brilliant light. The treads were narrow and the climb was steep. I looked down lest I misstep and fall, and noticed that each stair step had a bold capital letter written on it. I took pains to memorize these letters as I climbed, reciting them in my head, wondering what they could mean. I was certain that if I could only understand them, they would reveal a great mystery. Suddenly, the stair was shaken as if by a massive earthquake, and began to split in two, right down the middle, coming apart like a zipper. I lunged for the handrail, missed, and plunged headfirst into the murky depths below. I seemed to fall endlessly, and as I fell, I was still reciting the letters, audibly now, shouting them into the darkness. I woke with a jolt. Amazed that I could still remember the sequence of letters, I immediately grabbed a pencil and committed the message to paper. Here is what I wrote:

GCTATGATGCAATGTGCCAATTAAAACCAGCGTACTCATTTTCAACGCACCTATTTCATTGTTGAAGATGAG GGTCGTGAAGAGTCTACATGGGAAAATACGTATTTTCAAGTACGCCCTCAGATCAACACTGAGATTGGTCAT ACCCAGAATGAAACATGGCAAATGATTAATGTTACAGAGTCTTAGTGGGAATCCACCCAAAATGAACATGTG AACGACCGCGAGGATACATGGGAAAATACGTATACCTGGCAAGATGAGGGTCGTGAAGAGTCTTTTCAACGC ACCTATACACACAGAGAAGAGCCTCAGATCAACACTTTTCAAGTACGCTTTCAAGTACGCGAAATCGGGCAT ACAATGATTAATGTTACAGAGTCTTGA
NOTE: The cache is only a few steps from a small side trail. If it looks like you need to go bushwhacking, look for another way. BEWARE of poison oak in the area. It was not there when we placed the cache, but the area is not maintained and quite a bit has grown since.

*** Congratulations to FTF JAShaws ***

Additional Hints (Decrypt)

[Hide] Vil-pbirerq fghzc nobhg 8 srrg sebz n fvqr genvy.

Decryption Key

A|B|C|D|E|F|G|H|I|J|K|L|M
-------------------------
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

(letter above equals below, and vice versa)