Skip to content

<

Geocacher Genome Project

A cache by Fat Chuck's offspring Send Message to Owner Message this owner
Hidden : 11/19/2011
Difficulty:
5 out of 5
Terrain:
2 out of 5

Size: Size:   regular (regular)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:

The cache is not at the posted coordinates. Please solve the puzzle below to discover the cache location. This puzzle was conceived, written and hidden by my son. I thought it was rather hard. He'd be delighted to hear what you think. This cache may only be done during daylight.

In 2003, the thirteen-year-long Human Genome Project was completed. The project identified the exact sequence of the three billion genetic base pairs (known as nucleotides) that makes up human DNA. They also identified all of the genes (sequences of nucleotides that code for a specific trait, like eye color) that influence our physical traits.

More recently, it was discovered that there is a specific nucleotide sequence that is unique to a subspecies of humans known as "Geocachers". This nucleotide sequence makes up a gene that codes for the innate ability to find what you're looking for. The exact sequence is as follows:

5' CTCATTTTGCTGCCAGGTGCTCTTAATACT
CGTATGCCCTATTTCGCGTACCTGGAACCA
CAGGATGTTGGTGTGGCCAATCTCTTCGTT
TATATTCTCATTTATGTTTAGGATATTGTT 3'

5' (five-prime) and 3' (three-prime) refer to which direction the strand of nucleotides is arranged. When two strands of nucleotides bind, like in normal DNA or when protein synthesis is taking place, they always run in opposite directions. The strand is always read 5'>3'.


Congratulations to Kelinore and JayB10 for FTF!

Additional Hints (Decrypt)

pbqba gnoyr

Decryption Key

A|B|C|D|E|F|G|H|I|J|K|L|M
-------------------------
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

(letter above equals below, and vice versa)



Reviewer notes

Use this space to describe your geocache location, container, and how it's hidden to your reviewer. If you've made changes, tell the reviewer what changes you made. The more they know, the easier it is for them to publish your geocache. This note will not be visible to the public when your geocache is published.