The idea for this cache began at the MSGA 6th Annual Celebrate Summer Event. KO_Cacher and I were eating a nice lunch, and I was explaining how science is a lot like doing a mystery cache. Many of the day to day activities of scientists are like solving bunches of small puzzles with the results hopefully adding up to help resolve some much bigger mystery. In fact, almost all the scientists I know are interested in many different kinds of puzzles. During the door prize portion of the event, we won a pre-stocked cache container and it seems this cache was fated to become reality.
The cache is not at the listed coordinates. You must solve all of the puzzles below, each representing a different type of research based science.
N AB° CD.EFG
W HIJ° KL.MNO
Chemistry
The following chemical reaction is involved in the production of silicon for the electronics industry. Balance the chemical equation to determine (B) and (E).
Na2SiF6 + (B)Na ==> Si + (E)NaF
Biology
We have all heard that geocaching is an addiction, but a recent discovery has found that it may even be encoded in the DNA of those who are afflicted. The following sequence was identified from individual “Bad” Ashe Cacher. Molecular Biologist’s are baffled, and would like the help of the geocaching community in solving the code. Can you help?
ATGCATGCTAATGATAATGCCAACGAC(+O)GCAAGGGAG(+Z)GAGCGG(+O)TAG
Concurrently, a group of geneticists have undertaken a study that has led them to believe that the urge to geocache is controlled by a single dominant gene. A biotechnology company is attempting to engineer this gene into mice as a first step in producing geocaching savy pets. In their most recent experiment, they have bred a male heterozygous at the geocaching locus with a female who is also heterozygous at the geocaching locus which resulted in the production of 12 offspring.
(A) = the predicted number of offspring that have the non-geocaching phenotype.
(J) = the predicted number of offspring that have the geocaching phenotype.
(K) = the predicted number of homozygous dominant offspring
(L) = the predicted number of homozygous recessive offspring
(M) = the predicted number of heterozygous offspring.
Physics
(C) is the resistance for the above circuit in ohms.
(D) is the number of significant figures in 0.0009
Mathematics
(G) = (J)
(C) = (F)
Complete the following calculations to determine (I)
1. Pick any number
2. add 7 to it.
3. subtract 2 from the result of step 2
4. substract the original number from the result of step 3
5. multiply the result of step 4 by 4
6. subtract 12 from the result of step 5 to give I.
You can check your answers for this puzzle on GeoChecker.com.
For those who like to wait to solve the hint on trail, be warned that it is double encoded.