Happy DNA Day! Today marks the anniversary of the publication of the scientific journal article describing the double helix structure of DNA.
CAUTION: Watch your step at GZ, especially in the winter due to the abandoned structure. There is a deep, open well here.
DNA encodes data using only four letters: adenine (A), thymine (T), guanine (G), and cytosine (C). These letters are read in groups of three per “word” (called a codon), and each word (codon) represents a different amino acid. For example, the codon ATG encodes the amino acid methionine. Each amino acid has a one letter abbreviation; for example methionine is abbreviated as M. To make a protein, many amino acids are attached together.
When a DNA sequence is translated, this means that you are determining which amino acids are encoded in the DNA sequence. To find the coordinates of this geocache, you must translate the short DNA sequence below into an amino acid sequence. Take the amino acid sequence and put together the single letter abbreviations. Together the letters will spell out a word to put into the geochecker, which will reveal the final coordinates.
tttcgcgcgaacaaactgattaac
You can validate your puzzle solution with certitude.