Skip to content

Cache Genomics 2.0 Mystery Cache

Hidden : 4/26/2020
Difficulty:
4 out of 5
Terrain:
2 out of 5

Size: Size:   micro (micro)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:


My cache called Cache Genomics was compromised to such an extend that I had to change its location. And with that the puzzle had to change. Same type of puzzle, different solution.


DNA, short for deoxyribonucleic acid, is the molecule that contains the genetic code of organisms. ... DNA is in each cell in the organism and tells cells what proteins to make. (https://simple.wikipedia.org/wiki/DNA)

DNA is built up from only 4 different nucleotides: Adenine (A), Thymine (T), Guanine (G), and Cytosine (C) and they are being read in triplets.

After extensive research the genome of this cache was determined and the DNA sequence is shown below. Read the code and find the cache.

CACCAGTGACATGTCCGTCGAGCCATTGGTCAGTCGATTGAACGTAGGCGGATTGACCAGTCGTGATATATTCCTCGAATTCGAGAACGGATTCCACCTGCCGCCCCTTGACATATTGCCCCTTGGATTTATCCTCATCCTCGAGCCATTCGTGTCCGGATTCGGCCTCATGAACGAATTCGGCCTCATGAACGAATTGACCCTAGGCGGATTCGTTGATATATTCAGTGACGGATTGACCAGTCGGTCATTCAGTGACGGATTCACCGTCACGAACGGATTCCTGCCATTCGTATTTGACGTTGACAGATTCAGTGAATTCGTATTACACCTGTCCGG

Additional Hints (Decrypt)

NGG vf fcnpr. Nqqvgvbany uvag va fbyhgvba.

Decryption Key

A|B|C|D|E|F|G|H|I|J|K|L|M
-------------------------
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

(letter above equals below, and vice versa)