My cache called Cache Genomics was compromised to such an extend that I had to change its location. And with that the puzzle had to change. Same type of puzzle, different solution.
DNA, short for deoxyribonucleic acid, is the molecule that contains the genetic code of organisms. ... DNA is in each cell in the organism and tells cells what proteins to make. (https://simple.wikipedia.org/wiki/DNA)
DNA is built up from only 4 different nucleotides: Adenine (A), Thymine (T), Guanine (G), and Cytosine (C) and they are being read in triplets.
After extensive research the genome of this cache was determined and the DNA sequence is shown below. Read the code and find the cache.
CACCAGTGACATGTCCGTCGAGCCATTGGTCAGTCGATTGAACGTAGGCGGATTGACCAGTCGTGATATATTCCTCGAATTCGAGAACGGATTCCACCTGCCGCCCCTTGACATATTGCCCCTTGGATTTATCCTCATCCTCGAGCCATTCGTGTCCGGATTCGGCCTCATGAACGAATTCGGCCTCATGAACGAATTGACCCTAGGCGGATTCGTTGATATATTCAGTGACGGATTGACCAGTCGGTCATTCAGTGACGGATTCACCGTCACGAACGGATTCCTGCCATTCGTATTTGACGTTGACAGATTCAGTGAATTCGTATTACACCTGTCCGG