Welcome to the 2nd A Puzzle of Life -- "Unseen Sequence!". The cache is NOT at the posted coordinates.
This puzzle will take you on a journey through the fascinating world of biology. Imagine the double helix spiraling through the cell, carrying the genetic instructions for building virtually every living organism. As you decode the sequence, visualize the twisting ladder of life, and let it guide you to the hidden message and eventually to the cache!
The Challenge:
To find the final coordinates of the cache, you need to decode and translate the letters from the puzzle into a "WORD!"
The Puzzle: GGAACGAUCCACAGCAUAAAUGGG!
The treasure awaits those with sharp minds and keen eyes. Good luck, and happy hunting!
There is a $2 bill tied with a green ribbon for the FTF!! Have Fun!
You can verify your puzzle solution here: CERTITUDE