Trail of Evidence Mystery Cache
Urubu: I inherited this cache from Flipsican LOOOOONG ago. It's more than run its course. Thanks to all finders.
Please note Use of geocaching.com services is subject to the terms and conditions
in our disclaimer.
Cache is not at the listed coords. You will have to decipher them from the info below.
Police report 7-30-05:
A body was found by cyclists in this pond at approximately 6pm. Upon investigation, the body was identified as the notorious cache thief Amos Ray Deer. He is believed to have made off with a new cache before he met his untimely demise. While there are no leads as to how Amos Ray met his end, police did send a blood sample off the to state crime lab. The DNA sequencing results are listed below.
ATTCATCAACCTGAATATCAAGTTGGTGAAACTACTCATATTTCTAATCAACGTACTCAT
ACTCATATTCGTACTTATACTTGGGAAAATACTTATTCTATTGTTCCTCAAATTAATACT
TGTGAACGTCAATCTATTGTTACTTATTCTGAAGTTGAAAATGAACTTGTTATTTCTCTT
ATTGTTGAATCTTGGGAATCTACTGAAATTGGTCATACTTATTTTCAAGTTCGTACTGAA
AATCCTCAAATTAATACTTCTATTGTTTCTGAAGTTGAAAATACTTATCAAAATGAAACT
CATGAAGGTGTTATTTGTGAAATTTCTCTTCAACAATCTGAA
Help solve this mystery by finding this cache. Cache has been identifed as a 2 quart plastic jar possibly containing stolen goods.
Additional Hints
(Decrypt)
Hfr gur fgvpx ergevriny zrgubq.
Bapr lbh unir genafyngrq erzrzore gung fbzrgvzrf D=B, T=W naq fbzrgvzrf I=H, fbzrgvzrf I=K naq fbzrgvzrf I=I. Jung vf fcnavfu sbe gur ahzore 0?
Treasures
You'll collect a digital Treasure from one of these collections when you find and log this geocache:
Loading Treasures