The Genesis
Code
Most seasoned geocachers have spent many hours pondering the
meaning of hidden messages to obtain the necessary GPS coordinates.
You've probably decryped simple
substitution ciphers and maybe even the more complex Vigenere
cipher. There are numerous examples of truly unique
cipher-based caches here in the central Illinois area.
However, there is a cipher that is universal to all life on
earth, yet many people have never heard of it.
The story of this code began in the
early 1950's when scientist began to realize that genetic
information was somehow encoded in a very unusual molecule
known as deoxyribonucleic acid, or more simply DNA. Biologists
Francis Crick and James Watson, used molecular photographs
obtained by Rosalind Franklin to determine that DNA consisted
of combinations of only four different molecules (abbreviated
A,T, G, and C) organized in two parallel chains and twisted in
a double helix.
It was known at the time that all proteins found in living
organisms were composed of combinations of 20 different amino acids
arranged in coiled chains of different lengths. Therefore, it was
hypothesized that the DNA somehow encoded the information to build
these protein chains in unlimited combinations and lengths.
In other words, the message
contained in the DNA chain would be used to synthesize a
subsequent protein chain, through another intermediate
molecular chain known as RNA. Numerous research laboratories
raced to discover the mystery of how DNA encoded this
information. It was in the spring of 1961 that a fairly
unknown scientist, Marshall Nirenberg, surprised many of the
renowned laboratories working on this research, by being the
first to reveal the translation cipher.
Since then, it has been established that all known living
organisms use this same translation to combine the assorted twenty
amino acids into proteins that serve as the machinery and building
blocks of life. It is difficult to not be marveled with the amazing
beauty and complexity of plant and animal Kingdoms that are borne
from such a simple strand of DNA.
Now see if you can find the hidden information found on this
strand of DNA.
taatgatagtagatggaaagcagcgcgggcgaataaagcaccgcgcgcacctaataagcg
taaagcatggcgcgcacctaatgcgcgtgccatgaacgctaatgcgcgaactaaagcgaa
gaataaacccatgcgacctaacatgcgctgttttaagaaattggccatacctattaaatt
agctaaacccatgaataaagcgcgatggaataagcgagctaatttattgtggaataaacc
attatggaaagctaagaaattggccatacctaataaacccatgaataatgcgcgtgccat
gaataaattagctaagcgacctaacatgcgctgttttaagaaattggccatacctattaa
gatgaaggccgcgaagaaagctaatttatttttacctattaaacccatcgcgaagaataa
accgcgaaagaataagcgtgggcgtattaatttattgtggaataagatgaatgcattatg
gcgctgtaaccgaacacctaaacccatcgcgaagaataaacccatcgcgaagaataaaac
attaacgaataaatgattaacagctaagcgaacgattaaacccatgaaaactaatgggaa
agcacctaagaaattggccatacctattaaaacattaacgaataagatgaaggccgcgaa
gaaagctaaacctgggaaaacacctattaaacccatcgcgaagaataagatgaatgcatt
atggcgctgtaaccgaacacctaagaaattggccatacctaaacccatcgcgaagaataa
acccatcgcgaagaataaatgattaacagctaataagaaaacgattaaatgagcagcggc
Park at the coordinates listed at the top of
the web page. You will notice that there are numerous trail
entrances all within several hundred yards of each other. They will
all get you to the cache without much difference in distance. Stay
on the trail until near the end when your GPS receiver will be
pointing towards a hill for the coordinates listed in the DNA code.
THE CACHE IS NOT HIDDEN ON THE HILLSIDE, but is on the top.
The cache is easily retrieved, so there is no need to be hanging
over any ledges.
Special thanks to the Metamora Park District Board of
Commissioners for permission to place this cache in Black Partridge
Park. Don't forget to check out the other great caches,
Creek Crossing and
Small Animals, while you are out here in the park. A nice
TRAIL MAP of Black Partridge Park is available through the
Peoria Area Mountain Biking Association. You may even see one of
their members doing a great job on extending the trails. As always,
follow the rules and be careful that you don't cause any damage
when walking off-trail.
NOTE ADDED MARCH 12, 2007. Several
people have questioned why the coded message uses such an odd
combination of math to figure out the coordinates. The reason is
because there are only 20 amino acids that are represented by 20
different single alphabetic letters. Regrettably, the unused
letters prevented me from easily spelling out certain numbers in
the coordinates. I tried my best to minimize confusion with the
letters that were available. If you’re able to decipher the
message, you probably can figure out the location. However, please
don’t hesitate to contact me if you want to confirm the coordinates
before heading to the cache site. Also, feel free to let me know if
you are stuck or need a little assistance. I won’t give you the
answer, but can probably help.
You can check your answers for this puzzle on
Geochecker.com.