Skip to content

Genesis Code II Mystery Cache

Hidden : 11/8/2006
Difficulty:
3.5 out of 5
Terrain:
3.5 out of 5

Size: Size:   regular (regular)

Join now to view geocache location details. It's free!

Watch

How Geocaching Works

Please note Use of geocaching.com services is subject to the terms and conditions in our disclaimer.

Geocache Description:

This is a fun hike in Black Partridge Park (Accessible from Cemetery Rd. in Metamora) and will probably take about 30 minutes each way. It shouldn't be any problem keeping your feet dry, since all the creek crossings are now "Bridge Crossings".



The Genesis Code


Most seasoned geocachers have spent many hours pondering the meaning of hidden messages to obtain the necessary GPS coordinates. Watson_and_Crick You've probably decryped simple substitution ciphers and maybe even the more complex Vigenere cipher. There are numerous examples of truly unique cipher-based caches here in the central Illinois area. However, there is a cipher that is universal to all life on earth, yet many people have never heard of it.

Rosalind_FranklinThe story of this code began in the early 1950's when scientist began to realize that genetic information was somehow encoded in a very unusual molecule known as deoxyribonucleic acid, or more simply DNA. Biologists Francis Crick and James Watson, used molecular photographs obtained by Rosalind Franklin to determine that DNA consisted of combinations of only four different molecules (abbreviated A,T, G, and C) organized in two parallel chains and twisted in a double helix.

It was known at the time that all proteins found in living organisms were composed of combinations of 20 different amino acids arranged in coiled chains of different lengths. Therefore, it was hypothesized that the DNA somehow encoded the information to build these protein chains in unlimited combinations and lengths. Protein_SynthesisIn other words, the message contained in the DNA chain would be used to synthesize a subsequent protein chain, through another intermediate molecular chain known as RNA. Numerous research laboratories raced to discover the mystery of how DNA encoded this information. It was in the spring of 1961 that a fairly unknown scientist, Marshall Nirenberg, surprised many of the renowned laboratories working on this research, by being the first to reveal the translation cipher.

Since then, it has been established that all known living organisms use this same translation to combine the assorted twenty amino acids into proteins that serve as the machinery and building blocks of life. It is difficult to not be marveled with the amazing beauty and complexity of plant and animal Kingdoms that are borne from such a simple strand of DNA.

Now see if you can find the hidden information found on this strand of DNA.


taatgatagtagatggaaagcagcgcgggcgaataaagcaccgcgcgcacctaataagcg taaagcatggcgcgcacctaatgcgcgtgccatgaacgctaatgcgcgaactaaagcgaa gaataaacccatgcgacctaacatgcgctgttttaagaaattggccatacctattaaatt agctaaacccatgaataaagcgcgatggaataagcgagctaatttattgtggaataaacc attatggaaagctaagaaattggccatacctaataaacccatgaataatgcgcgtgccat gaataaattagctaagcgacctaacatgcgctgttttaagaaattggccatacctattaa gatgaaggccgcgaagaaagctaatttatttttacctattaaacccatcgcgaagaataa accgcgaaagaataagcgtgggcgtattaatttattgtggaataagatgaatgcattatg gcgctgtaaccgaacacctaaacccatcgcgaagaataaacccatcgcgaagaataaaac attaacgaataaatgattaacagctaagcgaacgattaaacccatgaaaactaatgggaa agcacctaagaaattggccatacctattaaaacattaacgaataagatgaaggccgcgaa gaaagctaaacctgggaaaacacctattaaacccatcgcgaagaataagatgaatgcatt atggcgctgtaaccgaacacctaagaaattggccatacctaaacccatcgcgaagaataa acccatcgcgaagaataaatgattaacagctaataagaaaacgattaaatgagcagcggc

Park at the coordinates listed at the top of the web page. You will notice that there are numerous trail entrances all within several hundred yards of each other. They will all get you to the cache without much difference in distance. Stay on the trail until near the end when your GPS receiver will be pointing towards a hill for the coordinates listed in the DNA code. THE CACHE IS NOT HIDDEN ON THE HILLSIDE, but is on the top. The cache is easily retrieved, so there is no need to be hanging over any ledges.

Special thanks to the Metamora Park District Board of Commissioners for permission to place this cache in Black Partridge Park. Don't forget to check out the other great caches, Creek Crossing and Small Animals, while you are out here in the park. A nice TRAIL MAP of Black Partridge Park is available through the Peoria Area Mountain Biking Association. You may even see one of their members doing a great job on extending the trails. As always, follow the rules and be careful that you don't cause any damage when walking off-trail.

NOTE ADDED MARCH 12, 2007. Several people have questioned why the coded message uses such an odd combination of math to figure out the coordinates. The reason is because there are only 20 amino acids that are represented by 20 different single alphabetic letters. Regrettably, the unused letters prevented me from easily spelling out certain numbers in the coordinates. I tried my best to minimize confusion with the letters that were available. If you’re able to decipher the message, you probably can figure out the location. However, please don’t hesitate to contact me if you want to confirm the coordinates before heading to the cache site. Also, feel free to let me know if you are stuck or need a little assistance. I won’t give you the answer, but can probably help.

You can check your answers for this puzzle on Geochecker.com.

Additional Hints (Decrypt)

Svaq n avpr ivrj bs gur inyyrl naq trg gb gur ebbg bs lbhe ceboyrz ol erzbivat gur haarprffnel qroevf.

Decryption Key

A|B|C|D|E|F|G|H|I|J|K|L|M
-------------------------
N|O|P|Q|R|S|T|U|V|W|X|Y|Z

(letter above equals below, and vice versa)