|
 |
If you've never met Cache and Cary, the first thing you need to know is that Cary has a tickle trunk. True, you may not always be able to see that tickle trunk but rest assured that Cary has one for he readily answers the call of anyone needing anything with "Oh! Do you need one? I've got one!" He then bounds off to retrieve said item(s) from his tickle trunk! If there is a "Tim 'The Toolman' Taylor" gene then Cary has it! He often spends lots of time in some of his favorite stores like Princess Auto and Dollarama! When he does, you never know what he will add to his tickle trunk this time! We also can't forget Cary's endless knowledge of obscure things!
Here are a few of the things I've seen that tickle trunk produce:
- endless supply of sparklers
- *all* Hula girl accessories from the grass skirt to the flowered bra!
- metal detector (Yes! He uses it for finding caches!)
- portable propane powered hot water heater
- Hula Hertz
- ladder for that cache just out of reach
- a supply of hand held, racket shaped, battery powered bug zappers
- chemical handling gloves
- uber police flashlight/batton
- lizard pens and lizard finger puppets
- all supplies for Smores including monster chocolate bars!
- Slappy the Geocaching Beaver
- turtle toilet seat cover
- portable power pac
- complete cache restoration supplies
- cammo doggy outfits
- dog treats galore even though Cary does not own a dog!
- the Big Brown Beaver!
And no one can miss the MBGA cache stickers as any cache that does not have one, Cary will stick one on it!
I've never met anyone who has a greater love of gadgets and be so generous and willing to help out with anything than Cary! This cache is for you Cary! Enjoy!
|
The posted coordinates will get you to the area but to find the cache you must solve the following:
CGTCCTCGCCAATCTCGAATT
CCCTTACATCAGAAGCGGAGC
H=0, I=6, K=1, L=7, P=9, Q=8, R=4, S=3
Congrats to ertyu on being FTF!
You can check your answers for this puzzle on Geochecker.com.
OR
Click here to verify coordinates on Evince.