Continuing the Legacy Mystery Cache
ZacharyKZH: Archiving to open up the spot for new caches
-
Difficulty:
-
-
Terrain:
-
Size: 
(micro)
Please note Use of geocaching.com services is subject to the terms and conditions
in our disclaimer.
The existence of Life is perhaps one of the Universe’s greatest mysteries. This cache, too, is a mystery, intertwined with something that is, according to Science, the essence of Life itself. As always, published coordinates are not where the cache is hidden. The actual GZ is a scenic place, and one that deserve more visitors. The cache location shall be revealed once you succeed in reaching the final step.
The puzzle is listed directly below, and the rest of the listing outlines some information that may help.
_______________________________________________________
THE PUZZLE
Geneticists have recently isolated a gene believed to be responsible for geocaching tendencies. Humans (and geodogs) with this particular DNA chain have been observed to have a higher probability of taking up the game or some similar activity. It has also been shown to be mildly hereditary. The template strand of the gene sequence is as follows:
CAGTCTTTCTCCTGGCAAGCCA
Can you, as an avid geocacher, figure out the information encrypted in this sequence? If you have understood the fundamentals of DNA coding outlined below, you should find this rather… basic. Good luck, and have fun!
Check the accuracy of your attempt at DNA transcription at GeoChecker.com.
_______________________________________________________
Background: The DNA
DNA, or its full name, deoxyribonucleic acid, is the instruction manual and blueprint of almost all living things. Every piece of information needed to construct a functioning organism; you, me, the plant on your sill, the cat wandering around the void deck, and dogs named Boo, are encoded in the full set of DNA, which is present in every single cell in the body. It’s pretty amazing when you reflect upon this; the fact that every cell in your body has the manual that has made, and still makes what you are today.
To solve this puzzle, you’ll need some basic understanding of how biological information is coded within the DNA.
The World’s Smallest Database
One of the most awe-inspiring facts about the DNA is that it’s an incredibly space-efficient storage house of data. Each cell in our body holds up to 1.5 GB of data. That’s the equivalent data capacity of thumb size memory card! And the human thumb itself already contains thousands of cells so it has a combined capacity of several thousand times that card. Now that’s extreme efficiency! So, how is the data stored?
The Base Pairs
The DNA is shaped as a double helix, or in layman terms, like a ladder with twisting parallel bars. This helix chain provides the support structure for the data carrying centre, that is, the base pairs which form the “rungs” of the DNA “ladder”. These order in which these pairs are arranged is the physical manifestation of the data that the DNA stores.
There are 4 types of bases that form the base pairs, namely adenine (A), cytosine (C), guanine (G) and thymine (T). Now, each base is picky with its companion, and will only pair with another specific base. Adenine will bond with thymine, and cytosine with guanine. In short, only A – T, and G – C pairings are allowed. The permutations of the 4 possible pairs, A – T, T – A, G – C and C – G, make up the information stored in DNA, and by extension, the entire genome (that is, the complete set of DNA that makes the organism). Thus, the four base pairs form a “language” with just 4 letters; A, C, G and T. When strung together to form a “word”, they give the cell the exact instructions to build the proteins which are absolutely essential for our growth and other physiological functions.
DNA Transcription
It would be completely useless to have all the information lying around if the body has no way of extracting and utilising it. This leads us to the idea of transcription. When the body needs to construct a particular protein, it sends a messenger to the library; the DNA database to extract the relevant information. This messenger has been given specific instructions by the boss (read: the cell) to look up a particular string of DNA and extract the required information.
Now, the DNA is normally a closed structure, as the rungs are connected to each other, with no contact points for anything to latch on. However, when this guy comes around, it splits the DNA into two strands (it’s two since DNA, after all, is a double helix) breaking the base pairs, one side of the couple on each strand, just like how a clothes zipper becomes unzipped.
It then reads the information from one of the two strands (known as the template strand). This strand codes the exact opposite data required by the messenger. Meanwhile, the other strand with the correct data is called the coding strand.
You may find it odd that it would read from the so-called “negative” of the strand with the required code. However, if you do a double take, and rethink this, you’d realise that to extract the correct data, the messenger has to, by trial and error, figure out from a set of 4 possible bases which of them would bond to the template. OK, you might be confused now… so here’s an example.
An example
Here’s a section of DNA:
G A T T A C A Coding strand
| | | | | | |
C T A A T G T Template strand
Now, the protein in question is coded by the sequence GATTACA, but to make a photocopy of the data for the boss to use, the messenger needs to match this sequence exactly. However, chemically, there’s no way to construct the message using the available materials and check for its validity using the coding strand. This is because similar bases (G with G, for instance) don’t like each other and there would be no reaction. To overcome this issue, the messenger needs to interact with the “negative”, i.e. the template strand. Then, the messenger figures out which of its pieces would pair up with the “negative” and work out the sequence from there.
So, given C, the messenger will test A, C, G and T inputs and find that G fits, thus, deducing the first letter of the code. Repeat this for the rest of the code (TAATGT) and the messenger will be able to deduce that GATTACA is the required code. Simple, isn’t it? And, yes, I was making a movie reference.
This is about all the technical information you need to solve the puzzle. Further reading may help, but my fear is that you may get bogged down with even more jargon, and lose sight of the forest for the trees.
Additional Hints
(Decrypt)
H1NT: N0T 2 P1