A small series for all the keen puzzle solving cache sleuths out there. For some cachers, puzzles are just in their DNA.
Having recently returned from a short trip to the South Island where over 400 solved puzzles were found, I know how satisfying it can be to put in the hard yards solving the puzzles and then successfully nailing the physical cache.
Some of these will be quick and easy solves and others may take a bit more time - it's just a question of finding the right key ..
CGCGGCTAAATGGGACTTCTTCTGATGGTTGGCATGGCGGGCGGCGCCAT
GCGTGTTATGGTCATGTGCTGTATGTGGTGTATGTTCTGTTGGATGCGTGGA
CTGATGCTTATGTCTTTCTGGATGGTTTAGGGCATGGTTTAGGGCATGTCTTTCTCT
Enjoy