Double Helix Mystery Cache
OReviewer: As there's been no response to my earlier post, I'm archiving this cache to prevent it from blocking other cache placements. If you wish to repair/replace the cache sometime in the future, just contact me (by email), including the GC Code or a link to the page, and assuming it meets the guidelines, I'll be happy to unarchive it.
-
Difficulty:
-
-
Terrain:
-
Size: 
(regular)
Please note Use of geocaching.com services is subject to the terms and conditions
in our disclaimer.
This cache is all about genetics, so fire up the logical half of your brain. The cache is NOT at the listed coordinates, though the listed coordinates WILL take you to a spot in the same park. The cache IS hidden at North 40.17.ABC, West 074.02.XYZ. To get the actual coordinates, you are going to have to tackle your own miniature Human Genome Project.
DNA is a molecule that stores all of the genetic information necessary for a living creature to exist, be it in the form of a single cell or a human being. Your task is to study the "Geocacher Gene", and ensure that it is expressed by building the protein necessary for a lifeform to undertake the task of geocaching. Once you have assembled this protein, you will be asked a series of questions about its basic structure. The answers will provide you with the coordinates for this cache. The actual cache is a pvc tube painted a brown color. Both ends screw open in case one gets stuck. PLEASE DO NOT FORCE the caps further than they screw. Once you meet a fair resistance, stop, or the cap's threads will jam. Container has room for small trade items, such as coins, only. Bring your own pen.
Here is the DNA sequence for the "Geocacher Gene":::
ATGCGGATAACGTCTAAGATCCGTATCCTTTGA
Here are the steps you must follow to successfully research the "Geocacher Gene":::
1- Assemble the complementary DNA strand that would be found opposite this segment in the double helix
2- Using the complementary strand you just assembled, build the RNA strand that would be built off of it.
3- Using the RNA strand, create the protein. To achieve this, break the strand up into sets of 3 letters. AUG is the start 'codon', while UGA is the STOP 'codon'. Using each of these 3 letter 'codons', find the amino acids they correspond to. Write the amino acid sequence out. You may find it useful to do a search on Wikipedia.com for "amino acids"...they have a very useful table for this near the bottom of the entry.
An alternative method is to use this site: (visit link)
I have found it works best with the RNA sequence. You will get the protein sequence, where each amino acid is represented by a single capitol letter. You can then match the capitol letters with amino acids at the wikipedia site as recommended above. All credit for finding this site goes to TucsonThompsen. A great find.
4- Taken together, this amino acid sequence forms the activated protein coded for by the "Geocacher Gene". It allows you to undertake the critical recreational activity of geocaching. Answer the following questions to get the coordinates for the cache:::
The cache is at: North 40.17.ABC, West 074.02.XYZ
where:::
A is the number of Proline (Pro) amino acids in the protein.
B is the (number of Arginine (Arg) amino acids multiplied by 3) +1
C is what number position the only Serine (Ser) occupies in the protein chain, counting left to right and including the START codon.
X is the number of Lysine (Lys) present in the chain, multiplied by 2
Y is the number of Isoleucine (Ile) present in the protein chain.
Z is the answer to Y multiplied by 3
The cache is located somewhere within the bounds of Leon B. Smock 80 Acres Park. The park entrance is off of Wall Street, across from where it intersects Industrial Way, in Eatontown, NJ. Parking is available at the park's entrance. The cache is near a trail, so you can keep bushwhacking to a bare minimum for this hunt.
If you need a hint or would like to confirm your coordinates before hunting for this cache, feel free to contact me via the geocaching.com email system.
Additional Hints
(Decrypt)
[Step 1] Yvxr chmmyr cvrprf, N naq G ner bccbfvgrf naq tb gbtrgure. Yvxrjvfr jvgu P naq T. Bgure pbzovangvbaf jvyy abg jbex.
[Step 2] Cebprrq whfg yvxr lbh qvq sbe fgrc bar, rkprcg gung G vf ercynprq ol n qvssrerag yrggre jura jbexvat jvgu EAN. H jvyy unir gb thrff juvpu. ;)
[Step 3]Gehfg zr, vs lbh ner abg n ovbybtl znwbe jvgu n grkgobbx unaql, gur jro frnepu erpbzzraqrq va gur qrfpevcgvba sbe guvf fgrc vf lbhe orfg, dhvpxrfg jnl gb zbir ba va guvf chmmyr.
[Step 4] Vs lbh pbzcyrgrq gur cerivbhf gnfxf pbeerpgyl, guvf svany fgntr jvyy or n cvrpr bs pnxr!
[Location] Gur pnpur vf ng jnvfg urvtug vafvqr n ubyybj gerr fghzc, abg zber guna 10 srrg sebz gur genvy. Vg oyraqf va irel jryy
Treasures
You'll collect a digital Treasure from one of these collections when you find and log this geocache:
Loading Treasures